Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866099:139866125:[+]	chr13:109562438:109562460:[+]	nonBSJ supported	CDS	circRNA 5':GUCUUC--CAGAAAAUCCACAUCUUCCAA 3' \|\|\|\|\| \|\|\|\| \|\|:\|\|\| \|\|\|\| target 3':AAGAAGUCGUCUAUUGGGU-----AGGU 5'	-18.20	7	RIC-seq
chrX:139866099:139866131:[+]	chr13:109562403:109562460:[+]	nonBSJ supported	CDS	circRNA 5':GUCUUC--CAGAAAAUCCA--CAUCUUCCAA---------------------UGGCCU 3' \|\|\|\|\| \|\|\|\| \|\|:\|\|\| \|\|\|\| \| \|\|\|\|\| target 3':AAGAAGUCGUCUAUUGGGUAGGUAGUUGUUCAUCUUUUACUCUUUUAACGAGACCGGU 5'	-25.00	6	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr13:109562403:109562460:[+]	target	-	chr13:109562450-109562451	C>T	LINC-JP	ICGC
chr13:109562438:109562460:[+]	target	-	chr13:109562450-109562451	C>T	LINC-JP	ICGC